addgene plasmid (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
addgene plasmid
Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 107 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgrna-bacteria+plasmid/pgRNA-bacteria+(Plasmid+%2344251)/pm41791393-564-222-222
Average 93 stars, based on 107 article reviews
Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 107 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgrna-bacteria+plasmid/pgRNA-bacteria+(Plasmid+%2344251)/pm41791393-564-222-222
Average 93 stars, based on 107 article reviews
addgene plasmid - by Bioz Stars,
2026-09
93/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: Rapid identification of key antibiotic resistance genes in E. coli using high-resolution genome-scale CRISPRi screening Article Snippet: .. To test the CRISPRi system, an mrfp - nptII (neomycin phosphotransferase; kanamycin resistance gene) cassette was introduced into E. coli K-12 MG1655 chromosomal DNA between lacI and lacZ via lambda recombination., dCas9 and sgRNA were expressed with separate plasmids, pdCas9 plasmid (cat. #46569; Addgene, Cambridge, MA, USA) and Article Title: CRISPRi screening reveals E. coli ’s anaerobic-like respiratory adaptations to gentamicin: membrane depolarization by CpxR Article Snippet: .. The plasmid backbone was also amplified by inverse PCR from the Article Title: CRISPRi screening reveals E. coli ’s anaerobic-like respiratory adaptations to gentamicin: membrane depolarization by CpxR Article Snippet: For library construction, E. coli Lucigen's Endura competent cells (Lucigen, WI, USA) were used, while E. coli K-12 MG1655 was employed for CRISPRi library screening. .. The pdCas9 plasmid (Addgene, cat. #46569) and the Article Title: CRISPRi screening reveals E. coli 's anaerobic-like respiratory adaptations to gentamicin: membrane depolarization by CpxR. Article Snippet: .. The plasmid backbone was also amplified by inverse PCR from the Article Title: CRISPRi screening reveals E. coli 's anaerobic-like respiratory adaptations to gentamicin: membrane depolarization by CpxR. Article Snippet: For library construction, E. coli Lucigen's Endura competent cells (Lucigen, WI, USA) were used, while E. coli K-12 MG1655 was employed for CRISPRi library screening. .. The pdCas9 plasmid (Addgene, cat. #46569) and the CRISPR:Article Title: The Role of L-Sorbose Metabolism in Enhancing Fitness and Virulence in Escherichia coli Under Acidic Conditions Article Snippet: .. Strain Construction The chromosomal gene sorD was deleted by CRISPR–Cas9-mediated genome editing in E. coli CFT073 as previously described, with appropriate modifications.27 Briefly, three 20-bp spacer fragments targeting sorD were digested with BsmBI (Thermo Scientific) and inserted into other:Article Title: The metabolome of an E. coli CRISPRi library identifies benefits of minimal metabolite levels and targets for engineering. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains YYdCas9: BW25993 intC::tetR-dcas9-aadA lacY::ypet-cat Lawson et al. 19 N/A Genotypes and base pairing sequences of arrayed CRISPRi strains are listed in Table S1 This paper N/A Chemicals, peptides, and recombinant proteins Anydrotetracylcine (hydrochloride) Cayman Chemicals Cat#10009542 Ampicillin sodium salt >97% Roth Cat#K029.4 Isopropanol/2-propanol, Rotisolv ≥99.95%, Ultra LC-MS Roth Cat#0733.2 Ammoniumcarbonate Sigma-Aldrich Cat#379999 Ammonium hydroxide TraceSELECT Ultra, 20-22% Honeywell/Fluka Cat#16748-250ML-F Acetonitril Chomasolv LC-MS ultra Honeywell/Riedel de Haen Cat#14261-1l Ammonium acetate ≥99.99% Sigma-Aldrich Cat#431311 InfinityLab Deactivator Additive/Medronic acid Agilent Technologies Cat#5191-4506 Acetone for HPLC VWR Chemicals Cat#20067.320 Sodium phosphate dibasic Roth Cat#P030.2 Potassium dihydrogen phosphate Roth Cat#3904.1 Sodium chloride Roth Cat#9265.1 Ammoniumsulfate Sigma-Aldrich Cat#A3920 Zinc sulfate heptahydrate Sigma-Aldrich Cat#Z0251 Copper(II)chloride dihydrate Sigma-Aldrich Cat#307483 Manganese sulfate monohydrate Sigma-Aldrich Cat#M8179 Cobalt(II) chloride hexahydrate Roth Cat#7095.1 Thiamine hydrochloride Sigma-Aldrich Cat#T4625 Magnesium sulfate Sigma-Aldrich Cat#63138 Calcium chloride dihydrate Sigma-Aldrich Cat#C8106 Iron(III)chloride hexahydrate Sigma-Aldrich Cat#31232 D-Glucose Roth Cat#X997.4 D-Glucose U-13 C 6 Cambridge Isotope Laboratory Cat#CLM-1396-10 LB Broth (Miller) Sigma-Aldrich Cat#L3522 HP-921 and purine in API-TOF Reference Mass Solution Kit Agilent Technologies G1969-85001 Deposited data FI-MS data MASSIVE repository MSV000098712 LC-MS/MS data MASSIVE repository MSV000098755 Targeted LC-MS/MS data MetE strain MASSIVE repository MSV000098714 Oligonucleotides Oligonucleotides used to construct sgRNAs are listed in Table S1 Sequencing primer for pgRNA plasmids: GGGTTATTGTCTCATGAGCGGATACATATTTG This paper N/A Recombinant DNA pgRNA-bacteria Qi et al. 20 Amplification:Article Title: CRISPRi screening reveals E. coli ’s anaerobic-like respiratory adaptations to gentamicin: membrane depolarization by CpxR Article Snippet: .. The plasmid backbone was also amplified by inverse PCR from the Article Title: CRISPRi screening reveals E. coli 's anaerobic-like respiratory adaptations to gentamicin: membrane depolarization by CpxR. Article Snippet: .. The plasmid backbone was also amplified by inverse PCR from the Inverse PCR:Article Title: CRISPRi screening reveals E. coli ’s anaerobic-like respiratory adaptations to gentamicin: membrane depolarization by CpxR Article Snippet: .. The plasmid backbone was also amplified by inverse PCR from the Article Title: CRISPRi screening reveals E. coli 's anaerobic-like respiratory adaptations to gentamicin: membrane depolarization by CpxR. Article Snippet: .. The plasmid backbone was also amplified by inverse PCR from the Expressing:Article Title: CRISPRi screening reveals E. coli ’s anaerobic-like respiratory adaptations to gentamicin: membrane depolarization by CpxR Article Snippet: For library construction, E. coli Lucigen's Endura competent cells (Lucigen, WI, USA) were used, while E. coli K-12 MG1655 was employed for CRISPRi library screening. .. The pdCas9 plasmid (Addgene, cat. #46569) and the Article Title: CRISPRi screening reveals E. coli 's anaerobic-like respiratory adaptations to gentamicin: membrane depolarization by CpxR. Article Snippet: For library construction, E. coli Lucigen's Endura competent cells (Lucigen, WI, USA) were used, while E. coli K-12 MG1655 was employed for CRISPRi library screening. .. The pdCas9 plasmid (Addgene, cat. #46569) and the |